View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4236_high_15 (Length: 234)

Name: NF4236_high_15
Description: NF4236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4236_high_15
NF4236_high_15
[»] chr1 (3 HSPs)
chr1 (71-177)||(41865000-41865106)
chr1 (169-221)||(41864885-41864937)
chr1 (1-53)||(41865199-41865251)


Alignment Details
Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 71 - 177
Target Start/End: Complemental strand, 41865106 - 41865000
Alignment:
71 ttgagcagtattttgatagtcgagatttacattgacacttccatctttgcgccaactttcttctctaccttccattatgtaactttcggtgatgaaatgt 170  Q
    ||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||    
41865106 ttgagcagtgttttgatagtcgagatttacattgagacttccatctttgcgccaactttcttctctaccttccattatgtaatttccggtgatgaaatgt 41865007  T
171 ttttgtt 177  Q
    |||||||    
41865006 ttttgtt 41865000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 169 - 221
Target Start/End: Complemental strand, 41864937 - 41864885
Alignment:
169 gtttttgttctatgactaatttccactgtgttctaacttattgatgagatttt 221  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||    
41864937 gtttttgttctatgactaattcccactgtgttctaacttattgatgagatttt 41864885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 41865251 - 41865199
Alignment:
1 taatttcaatctgaattgatgcattaaaaatatgtgtaatcaagccattatta 53  Q
    |||||||||||||| || |||||||| ||||||| ||||||||||||||||||    
41865251 taatttcaatctgagttaatgcattagaaatatgcgtaatcaagccattatta 41865199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University