View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4236_high_15 (Length: 234)
Name: NF4236_high_15
Description: NF4236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4236_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 71 - 177
Target Start/End: Complemental strand, 41865106 - 41865000
Alignment:
| Q |
71 |
ttgagcagtattttgatagtcgagatttacattgacacttccatctttgcgccaactttcttctctaccttccattatgtaactttcggtgatgaaatgt |
170 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
41865106 |
ttgagcagtgttttgatagtcgagatttacattgagacttccatctttgcgccaactttcttctctaccttccattatgtaatttccggtgatgaaatgt |
41865007 |
T |
 |
| Q |
171 |
ttttgtt |
177 |
Q |
| |
|
||||||| |
|
|
| T |
41865006 |
ttttgtt |
41865000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 169 - 221
Target Start/End: Complemental strand, 41864937 - 41864885
Alignment:
| Q |
169 |
gtttttgttctatgactaatttccactgtgttctaacttattgatgagatttt |
221 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41864937 |
gtttttgttctatgactaattcccactgtgttctaacttattgatgagatttt |
41864885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 41865251 - 41865199
Alignment:
| Q |
1 |
taatttcaatctgaattgatgcattaaaaatatgtgtaatcaagccattatta |
53 |
Q |
| |
|
|||||||||||||| || |||||||| ||||||| |||||||||||||||||| |
|
|
| T |
41865251 |
taatttcaatctgagttaatgcattagaaatatgcgtaatcaagccattatta |
41865199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University