View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4236_high_16 (Length: 217)
Name: NF4236_high_16
Description: NF4236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4236_high_16 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 5 - 217
Target Start/End: Complemental strand, 36560591 - 36560381
Alignment:
| Q |
5 |
tgatttagtgaggtaacaggctatgagactattcctcatggttctctctttgaattatcattgcaatgtctctacattaaggtttctagttcactctata |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36560591 |
tgatttagtgaggtaacaggctatgagactattcctcatggttctctctttgaattatcattgcaatgtccctacattaaggtttctagttcactctata |
36560492 |
T |
|
| Q |
105 |
tggtccatttcaatgttccatggactctgttttttaactatggattgtcattgcaatgcctctatattaaggtttctagttcattgtatcaagaaacttg |
204 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36560491 |
tggtccatttcaatgttccatggactc--ttttttaactatggattatcattgcaatgcctctatattaaggtttctagttcattatatcaagaaacttg |
36560394 |
T |
|
| Q |
205 |
ttacatttgcatc |
217 |
Q |
| |
|
||||||||||||| |
|
|
| T |
36560393 |
ttacatttgcatc |
36560381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 38480512 - 38480429
Alignment:
| Q |
1 |
atagtgatttagtgaggtaacaggctatgagactattcctcatggttctctctttgaattatcattgcaatgtctctacattaa |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38480512 |
atagtgatttagtgaggtaacaggctatgagactattcctcatggttctctctttgaattatcattgcaatgtctctacattaa |
38480429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University