View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4236_low_10 (Length: 266)
Name: NF4236_low_10
Description: NF4236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4236_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 175 - 254
Target Start/End: Original strand, 2245439 - 2245518
Alignment:
| Q |
175 |
agtaattgtacatgattgttattgttgagctaaattgagtagtactggtcaaatgcgtgtgaatattatttacttgcttc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2245439 |
agtaattgtacatgattgttattgttgagctaaattgagtagtactagtcaaatgcgtgtgaatattatttacttgcttc |
2245518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 18 - 143
Target Start/End: Original strand, 2245288 - 2245407
Alignment:
| Q |
18 |
ataatgttcacaacggattttctggttttctggaatgaaaacnnnnnnngtacagtatattatatatatgtcaattaaggcagaatctaaaaccatatgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | ||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2245288 |
ataatgttcacaacggattttctggttttctggaatgaaaacaaaaaa---aaagtatat---atatatgccaattaaggcagaatctaaaaccatatgg |
2245381 |
T |
 |
| Q |
118 |
tgtttgaggaaattgaatttgaagga |
143 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
2245382 |
tgtttgaggaaattgaatttgaagga |
2245407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University