View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4236_low_14 (Length: 242)
Name: NF4236_low_14
Description: NF4236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4236_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 76 - 228
Target Start/End: Original strand, 37432704 - 37432856
Alignment:
| Q |
76 |
gaatgttatgttcatttcatcttgtatatactatcgacttttaattttggtagtagctaaataattttcatttttgcatgatattgtaggcacggaagaa |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37432704 |
gaatgttatgttcatttcatcttgtatatactatcgacttttaattttggtagtagctaaataattttcatgtttgcatgatattgtaggcacggaagaa |
37432803 |
T |
|
| Q |
176 |
gatagctaaatcattgcaacctgttgtggatgaaaggaggttgataataaaaa |
228 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37432804 |
gatagctaaattattgcaacctgttgtggatgaaaggaggttgatgataaaaa |
37432856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University