View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4236_low_6 (Length: 371)
Name: NF4236_low_6
Description: NF4236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4236_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 18 - 360
Target Start/End: Original strand, 40079329 - 40079671
Alignment:
| Q |
18 |
attcctccaactctgccttgatttgtttaatccttggtccgtttatgattgagaattgttccttgatgtcttcccacaaatcttttacatcctcttggtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40079329 |
attcctccaactctgccttgatttgtttaatccttggtccgtttatgattgagaattgttccttgatgtcctcccacaaatcttttacatcctcttggtt |
40079428 |
T |
 |
| Q |
118 |
ggagataggtataatgcaagctcggctccaccatatttcgtacccatgtcaccgacattgacatgggttggattgtcgactaatcctctagatatgacga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40079429 |
ggagataggtataatgcaagctcggctccaccatatttcatacccatgtcaccgacattgacatgggttggattgtcgactaatcctctagatatgacga |
40079528 |
T |
 |
| Q |
218 |
atccttctttattgtacaatgactctttctacgaatctccactatgtctcgcaagaaaggaagtttgtatcgcattataacactttctccactttcagtt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40079529 |
atccttctttattgtacaatgactctttctacgaatctccactatgtctcgcaagaaaggaagtttgtatcgcattagaacactttctccactttcagtt |
40079628 |
T |
 |
| Q |
318 |
gaacccaaaatatcaaattctctctgttgttatttgaattcat |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40079629 |
gaacccaaaatatcaaattctctctgttgttatttgaattcat |
40079671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University