View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4237_high_16 (Length: 228)
Name: NF4237_high_16
Description: NF4237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4237_high_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 17 - 210
Target Start/End: Original strand, 4315547 - 4315740
Alignment:
| Q |
17 |
atggagattggaccgaaagagataaaatcagagattgattatttgtatctggtgcagtaaggtcgagttgttactttgtgaaagtgtgtgttgctgttgt |
116 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4315547 |
atggagattggatcgaaagagatgaaatcagagattgattatttgtatctggtgcagtaaggtcaagttgttactttgtgaaagtgtgtgttgctgttgt |
4315646 |
T |
|
| Q |
117 |
catgtgtgaatatggtctcagtaacgacaaggaaataggcataggatgctgaaatggatccattccccgaaaagtttcacatgaatgaatgaat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4315647 |
catgtgtgaatatggtctcagtaacgacaaggaaataggcataggatgctgaaatggatccattcaccgaaaagtttcacatgaatgaatgaat |
4315740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University