View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4237_low_19 (Length: 229)
Name: NF4237_low_19
Description: NF4237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4237_low_19 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 7 - 229
Target Start/End: Complemental strand, 1905074 - 1904844
Alignment:
| Q |
7 |
caccaaagagaaaggcaaacaaact---catgtgtctctcttggtcacgtattgcatgcctcaaacttatttttgaaaattcaaagaatttaattactat |
103 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||| ||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1905074 |
caccaaagagaaaggcaactaaactagtcatgtgtctctcttggtcacctattgtatatctcaaacttatttttgaaaattcaaagaatttaattactat |
1904975 |
T |
|
| Q |
104 |
gcattgatatttaaagctggttagtct-aaaagtcaataa---tggttgattgataatttagttaacacc-nnnnnnngacaaatgtgttgggtagagtg |
198 |
Q |
| |
|
||||||||||||||||||||||| ||| || ||||||| ||||||||| ||||||||||||||||| ||||||||| | ||||||||| |
|
|
| T |
1904974 |
gcattgatatttaaagctggttaatctgtgaattcaataatactggttgatttataatttagttaacacctttttttttacaaatgtgataggtagagtg |
1904875 |
T |
|
| Q |
199 |
aaaagacttgagtgacataggcttttgtaat |
229 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |
|
|
| T |
1904874 |
aaaagacttgggtgacataggcttttgtaat |
1904844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University