View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4237_low_4 (Length: 425)
Name: NF4237_low_4
Description: NF4237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4237_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 160 - 412
Target Start/End: Complemental strand, 4840678 - 4840430
Alignment:
| Q |
160 |
tataacttttgttttgcttctctttattgctcctcccttttagttgaaatannnnnnnnagggnnnnnnnnctaatagatattaacaaatccttacccct |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||||||| |||| |
|
|
| T |
4840678 |
tataacttttgttttgcttctctttattgctcctcccttttagttgaaatattttttttaggaaaaaaaaactaatagatattagcaaatccttatccct |
4840579 |
T |
|
| Q |
260 |
ttaaaaatagaagaatct-tttttaaagaagatgatgaaattgctaatgcccagtaatcttttaaacatcagaattaaattaaattaaaagtcttacagt |
358 |
Q |
| |
|
||| ||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| | |
|
|
| T |
4840578 |
ttacaaagagaagaatctctttttaaagaagatgatgaaattgctaatgcccagtaatcttttaaacatcagaattaaattaaat-----gtcctacatt |
4840484 |
T |
|
| Q |
359 |
tatctattttttgatatagtcttgagcgctttatttataagggtaggttatctc |
412 |
Q |
| |
|
||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4840483 |
tatatattttttgatatagtcttgagtgctttatttataagggtaggttatctc |
4840430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 361 - 411
Target Start/End: Complemental strand, 4842906 - 4842856
Alignment:
| Q |
361 |
tctattttttgatatagtcttgagcgctttatttataagggtaggttatct |
411 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||| ||||| |||||| |
|
|
| T |
4842906 |
tctattctttgatattgtcttgagcgctttatttataacggtagcttatct |
4842856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University