View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4238_high_11 (Length: 237)
Name: NF4238_high_11
Description: NF4238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4238_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 42 - 221
Target Start/End: Complemental strand, 9670249 - 9670078
Alignment:
| Q |
42 |
ctatttgaaaatgcacacgttttttagatttgcatttaattcaatttattgataagtgtaaaagttggaccctatagttaacctagtatgcgacaagccg |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9670249 |
ctatttgaaaatgcacacgttttttagatttgcatttaattaaatttattgataagtgtaaaagttggaccctatagttaacctagtatgcgac------ |
9670156 |
T |
 |
| Q |
142 |
atacttccacttcccaagttagaatatgtgtaactcaatgcctaaaatattgaacagtttgtccataatctaatctgtct |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9670155 |
--acttccacttcccaagttagaatatgtgtaactcaatgcctaaaatattgaacagtttgtccataatctaatctgtct |
9670078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 149 - 222
Target Start/End: Complemental strand, 9689454 - 9689381
Alignment:
| Q |
149 |
cacttcccaagttagaatatgtgtaactcaatgcctaaaatattgaacagtttgtccataatctaatctgtctt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| ||| ||| ||||||||||| |||| |
|
|
| T |
9689454 |
cacttcccaagttagaatatgtgtaactcaatgcctaaaatatcgaaccgttgctccctaatctaatctctctt |
9689381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 175
Target Start/End: Complemental strand, 9671916 - 9671881
Alignment:
| Q |
140 |
cgatacttccacttcccaagttagaatatgtgtaac |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
9671916 |
cgatacttccacttcccaagttagaatatgtgtaac |
9671881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University