View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4238_low_11 (Length: 244)
Name: NF4238_low_11
Description: NF4238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4238_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 13 - 230
Target Start/End: Original strand, 48288036 - 48288253
Alignment:
| Q |
13 |
cataatgtggtgggtatgcatcttggatttgtcaaggaacaaagatgcccccttatcccctcttattaattaactatgagagaattgagaaaaggaaata |
112 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48288036 |
cataatgtggtgggtatgcaacttggatttgtcgaggaacaaagatgccccctcatcccctcttattaattaactatgagagaattgagaaaaggaaata |
48288135 |
T |
|
| Q |
113 |
atcaggtagacaattaaacaatgttacctttttaaggtgtatgtatcattctcttctgaaactatggtaatgggagagtttgaggaccaagactaccttg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48288136 |
atcaggtagacaattaaacaatgttacctttttaaggtgtatgtatcattctcttatgaaactatggtaatgggagagcttgaggaccaagactaccttg |
48288235 |
T |
|
| Q |
213 |
agaatcaaaaggtgaaat |
230 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
48288236 |
agaatcaaaaggtgaaat |
48288253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University