View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4239_high_6 (Length: 331)
Name: NF4239_high_6
Description: NF4239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4239_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 288; Significance: 1e-161; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 20 - 323
Target Start/End: Complemental strand, 32138875 - 32138572
Alignment:
| Q |
20 |
caacccaggacaaaatgtcgtggtttcacgcttcctattctcatgtgcaccaactttcttactaaaaggacttgcaagtggtgcttctggtatggctggt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32138875 |
caacccaggacaaaatgtcgtggtttcacgcttcctattctcatgtgcaccaactttcttactaaaaggacttgcaactggtgcttctggtatggctggt |
32138776 |
T |
 |
| Q |
120 |
cttggaagaaccaaaatagctcttccatctcaactagcttcggcttttagcttcgctagaaaattcgctatttgtctttcctcttcaaagggagttgttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32138775 |
cttggaagaaccaaaatagctcttccatctcaactagcttcggcttttagcttcgctagaaaattcgctatttgtctttcctcttcaaagggagttgttt |
32138676 |
T |
 |
| Q |
220 |
tattcggggatggaccttacggttttcttcccaacgttgtttttgattcagattcgcttacatatacaccgcttttgatcaatcctgttagcacaggttc |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32138675 |
tattcggggatggaccttacggttttcttcccaacgttgtttttgactcggattcgcttacatatacaccgcttttgatcaatcctgttagcacagcttc |
32138576 |
T |
 |
| Q |
320 |
tgct |
323 |
Q |
| |
|
|||| |
|
|
| T |
32138575 |
tgct |
32138572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 20 - 315
Target Start/End: Complemental strand, 32148265 - 32147970
Alignment:
| Q |
20 |
caacccaggacaaaatgtcgtggtttcacgcttcctattctcatgtgcaccaactttcttactaaaaggacttgcaagtggtgcttctggtatggctggt |
119 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32148265 |
caacccaggacaaaatgtcatggtttcacgcttcctattctcatgtgcacgaactttcttactagaaggacttgcaagtggtgcttctggtatggctggt |
32148166 |
T |
 |
| Q |
120 |
cttggaagaaccaaaatagctcttccatctcaactagcttcggcttttagcttcgctagaaaattcgctatttgtctttcctcttcaaagggagttgttt |
219 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32148165 |
cttggaagaaacaaattagctcttccatctcaattagcttcggcttttagcttcgctaaaaaattcgctatttgtctttcctcttcaaagggagttgttt |
32148066 |
T |
 |
| Q |
220 |
tattcggggatggaccttacggttttcttcccaacgttgtttttgattcagattcgcttacatatacaccgcttttgatcaatcctgttagcacag |
315 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||||||||| | || || ||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
32148065 |
tattcggggatggaccttacggttttctccccaacgtcgtttttgattctaagtcactcacatacacaccgcttttgatcaatccctttagcacag |
32147970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 20 - 206
Target Start/End: Complemental strand, 32127092 - 32126906
Alignment:
| Q |
20 |
caacccaggacaaaatgtcgtggtttcacgcttcctattctcatgtgcaccaactttcttactaaaaggacttgcaagtggtgcttctggtatggctggt |
119 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||| ||||| ||||| |||||||| | ||| || |||||||||| ||||||||||||| ||||||||| |
|
|
| T |
32127092 |
caacacaggacaaaatgtcgttgtttcacgctttctattttcatgcgcaccaacatcattattacgaggacttgcaggtggtgcttctggcatggctggt |
32126993 |
T |
 |
| Q |
120 |
cttggaagaaccaaaatagctcttccatctcaactagcttcggcttttagcttcgctagaaaattcgctatttgtctttcctcttca |
206 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| ||||||| ||| |||||||| ||| ||||| |||| |||||| |
|
|
| T |
32126992 |
cttggaagaaccaaaatcgctcttccatctcaactagcttctgcttttattttcaaaagaaaatttgctttttgtttttcttcttca |
32126906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University