View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4239_low_20 (Length: 239)
Name: NF4239_low_20
Description: NF4239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4239_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 34 - 208
Target Start/End: Original strand, 43130610 - 43130782
Alignment:
| Q |
34 |
tggggttgttcaacttcaaaatcaacattcttcgcaaaatccaaatgctaaagcactacaactagaagtactttagtctataggttacgtannnnnnngt |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
43130610 |
tggggttgttcaacttcaaaatcaacattcttcgcaaaatccaaatgctaaagcactacaactagaagtactttagtctataggttacgtatttttttgt |
43130709 |
T |
 |
| Q |
134 |
aataatgtggtactactgttttcttgttgatannnnnnnaatttcacatggtcggattttttgtttagagattta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
43130710 |
aataatgtggtactactgttttcttgttgatatttttt--atttcacatggttggattttttgtttagagattta |
43130782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University