View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4239_low_25 (Length: 208)
Name: NF4239_low_25
Description: NF4239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4239_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 32938180 - 32938374
Alignment:
| Q |
1 |
ttgtaggtatcttcctctgtgatgactgttagcctactgcttgttgctacagcattttatctacaggttggtaattaattatcacatctcttgaaattta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32938180 |
ttgtaggtatcttcctctgtgatgactgttagcctactgcttgttgctacagcattttatctacaggttggtaattaat---cacatctcttgaaattta |
32938276 |
T |
 |
| Q |
101 |
attcaatttttatactaaataattgatgttatttaattgaactcagggagttgtaacaagtggctctgacctttatagaatgatggggatgctctctg |
198 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32938277 |
attcaatttttacactaaataattgatgttatttaattgaactcagggagttgtaacaagtggctctgacctttatagaatgatggggatgctctctg |
32938374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University