View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4240_high_10 (Length: 251)

Name: NF4240_high_10
Description: NF4240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4240_high_10
NF4240_high_10
[»] chr6 (2 HSPs)
chr6 (45-152)||(6033866-6033974)
chr6 (170-234)||(6033795-6033858)


Alignment Details
Target: chr6 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 45 - 152
Target Start/End: Complemental strand, 6033974 - 6033866
Alignment:
45 gcaaaaatcaatgaaaaattaacaagtcaaaattttaatcctaagaacccttc-aaactcttgcacatatggcggatggtcataagaattgtaagaagtc 143  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| ||||||||||||||||    
6033974 gcaaaaatcaatgaaaaattaacaagtcaaaattttaatcctaagaacccttcaaaactcttgcacatatggccgatggtcatcagaattgtaagaagtc 6033875  T
144 tttaaaatc 152  Q
    |||||||||    
6033874 tttaaaatc 6033866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 170 - 234
Target Start/End: Complemental strand, 6033858 - 6033795
Alignment:
170 ttaaaatgtgtctggtgttcgcacatatcgattataagtgatctttgacgtgaccatttcaacca 234  Q
    |||||||||| |||||||||||| |||| || |||||||||||||| ||||||||| ||||||||    
6033858 ttaaaatgtg-ctggtgttcgcatatattgactataagtgatctttaacgtgaccaattcaacca 6033795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University