View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4240_high_10 (Length: 251)
Name: NF4240_high_10
Description: NF4240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4240_high_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 45 - 152
Target Start/End: Complemental strand, 6033974 - 6033866
Alignment:
| Q |
45 |
gcaaaaatcaatgaaaaattaacaagtcaaaattttaatcctaagaacccttc-aaactcttgcacatatggcggatggtcataagaattgtaagaagtc |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
6033974 |
gcaaaaatcaatgaaaaattaacaagtcaaaattttaatcctaagaacccttcaaaactcttgcacatatggccgatggtcatcagaattgtaagaagtc |
6033875 |
T |
 |
| Q |
144 |
tttaaaatc |
152 |
Q |
| |
|
||||||||| |
|
|
| T |
6033874 |
tttaaaatc |
6033866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 170 - 234
Target Start/End: Complemental strand, 6033858 - 6033795
Alignment:
| Q |
170 |
ttaaaatgtgtctggtgttcgcacatatcgattataagtgatctttgacgtgaccatttcaacca |
234 |
Q |
| |
|
|||||||||| |||||||||||| |||| || |||||||||||||| ||||||||| |||||||| |
|
|
| T |
6033858 |
ttaaaatgtg-ctggtgttcgcatatattgactataagtgatctttaacgtgaccaattcaacca |
6033795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University