View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4240_high_13 (Length: 222)
Name: NF4240_high_13
Description: NF4240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4240_high_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 127 - 189
Target Start/End: Original strand, 23455882 - 23455944
Alignment:
| Q |
127 |
ttgaaacccttcttttttcttcatccttctcttctattcccttatctcaaactcattcgaaca |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23455882 |
ttgaaacccttcttttttcttcatccttctcttctattcccttatctcaaactcattcgaaca |
23455944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 139 - 169
Target Start/End: Original strand, 19627419 - 19627449
Alignment:
| Q |
139 |
ttttttcttcatccttctcttctattccctt |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
19627419 |
ttttttcttcatccttctcttctattccctt |
19627449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University