View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4240_high_14 (Length: 217)
Name: NF4240_high_14
Description: NF4240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4240_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 2257374 - 2257171
Alignment:
| Q |
1 |
attggttgaaaaatcaccaccctgtgttgccaaaatcacaaggcttcaatgaaatagttagcgaacgagacgggtgtgatgctcaatcgatccttccatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
2257374 |
attggttgaaaaatcaccaccctgtgttgccaaaatcacaaggcttcaatgaaataggtagcgaacgtgacgggtgtgatgctcaatcgatcattccatg |
2257275 |
T |
 |
| Q |
101 |
ctacagagaccgggaacataaactcgacatcaaatacatcggatttgagaaaatttgattcttcgcacggttttcatccatattcacaactttcaactgt |
200 |
Q |
| |
|
| |||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2257274 |
ccacagagaccgggaacataaacttgacaacaaacacatcggatttgagaaaatttgattcttcgcacggttttcatccatatccacaactttcaactgt |
2257175 |
T |
 |
| Q |
201 |
tttc |
204 |
Q |
| |
|
|||| |
|
|
| T |
2257174 |
tttc |
2257171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University