View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4240_high_15 (Length: 213)
Name: NF4240_high_15
Description: NF4240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4240_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 4e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 20 - 165
Target Start/End: Complemental strand, 19378569 - 19378424
Alignment:
| Q |
20 |
aaaattgtgtgattgactttgcaacatcctttctgtttcatattgtattgtcgcatttaatcaatattgaaacaatgaagctggcatttgcttgactcat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19378569 |
aaaattgtgtgattgactttgcaacatcctttctgtttcatattgtattgtcgcatttaatcaatattgaaacaatgaagctggcatttgcttgactcat |
19378470 |
T |
 |
| Q |
120 |
cagataatttcaaactagactagtcattttggatcgacattatgat |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19378469 |
cagataatttcaaactagactagtcattttggatcgacattatgat |
19378424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 20 - 162
Target Start/End: Complemental strand, 18018680 - 18018522
Alignment:
| Q |
20 |
aaaattgtgtgattgactt-tgcaacatcctttctgtttcatattgtattgtcgcatttaatcaatattgaaacaatgaagctgg--------------- |
103 |
Q |
| |
|
||||||||||||||||||| ||| ||| | | ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18018680 |
aaaattgtgtgattgacttctgccacaacatctctgtttcatattgtattgtcgcatttaatcaatagtgaaacaatgaagctggaaattctatctctat |
18018581 |
T |
 |
| Q |
104 |
catttgcttgactcatcagataatttcaaactagactagtcattttggatcgacattat |
162 |
Q |
| |
|
|||||||||| |||||| | || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
18018580 |
tatttgcttgaatcatcacacaaattcaaactagactagtcattttggatcgacattat |
18018522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University