View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4240_high_7 (Length: 354)
Name: NF4240_high_7
Description: NF4240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4240_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 2e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 18 - 178
Target Start/End: Complemental strand, 7270928 - 7270768
Alignment:
| Q |
18 |
gttgttgctgagaagaaaattgtttaatnnnnnnncgaaaacgagtggatgatgatgatgaagattttggggattttaatctctttatgttggtttgttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7270928 |
gttgttgctgagaagaaaattgtttaataaaaaaacgaaaacgagtggatgatgatgatgaagattttggggattttaatctctttatgttggtttgttt |
7270829 |
T |
 |
| Q |
118 |
tggctttgatttgataaatgtagtgaaataaaatttggattttctatctcttttaatgaag |
178 |
Q |
| |
|
||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7270828 |
tggatttgatttgataaatgtagtgaaatgaaatttggattttctatctcttttaatgaag |
7270768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 190 - 230
Target Start/End: Complemental strand, 7270748 - 7270708
Alignment:
| Q |
190 |
ctgggtttggttgaagataaatgttttgaagatgaagcttt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7270748 |
ctgggtttggttgaagataaatgttttgaagatgaagcttt |
7270708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University