View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4240_low_6 (Length: 374)
Name: NF4240_low_6
Description: NF4240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4240_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 20 - 272
Target Start/End: Original strand, 50670446 - 50670698
Alignment:
| Q |
20 |
ttttacaaaaaggggactgcaaggtgcctctttggatgccaagagaatagctgatgacattgaactgtgtttagaagctgaagcaaagcatggatcataa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
50670446 |
ttttacaaaaaggggactgcaaggtgcctctttggatgccaagagaatagctgatgacattgaactgtgtttagaatctgaagcaaagtatggatcataa |
50670545 |
T |
|
| Q |
120 |
ataattatataaagagcaatttttaattgctccctcaattttgccacataaaattgataattttggccaggtgatagacacaaaagaaaagggattgatc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50670546 |
ataattatataaagagcaatttttaattgctccctcaattttgccacataaaattgataattttggccaggtgatagacacaaaagaaaagggattgatc |
50670645 |
T |
|
| Q |
220 |
attgaaaacaaatgatcattatcattgatatttgatcttggctgagtaacaga |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50670646 |
attgaaaacaaatgatcattatcattgatatttgatcttggctgagtaacaga |
50670698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 305 - 368
Target Start/End: Original strand, 50670731 - 50670794
Alignment:
| Q |
305 |
gaggaatatattgaattgaggtaggtttggtatataaatgaatggaaaatgagatattcttgga |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
50670731 |
gaggaatatattgaattgaggtaggtttggtatataaatgaatggaaaatgagatatttttgga |
50670794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University