View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4240_low_9 (Length: 284)
Name: NF4240_low_9
Description: NF4240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4240_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 9546075 - 9546232
Alignment:
| Q |
18 |
ttttcaatgttaattttttcatgttgttgtgaaattgaataatcaccaccactttctgcaacttgtttatttttcttgtgactcgctctgtgtccaccta |
117 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9546075 |
ttttcaatgttaattttttcatgatgttgtgaaattgaataatcaccaccactttctgcaacttgtttatttttcttgtgactcgctctgtgtccaccta |
9546174 |
T |
 |
| Q |
118 |
gtgcttgatatgaacgaaacactttgttacacgtgtcgcatttgtatcttcctcgtac |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9546175 |
gtgcttgatatgaacgaaacactttgttacacgtgtcgcatttgtatcttcctcgtac |
9546232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University