View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4241_high_5 (Length: 254)
Name: NF4241_high_5
Description: NF4241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4241_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 12 - 248
Target Start/End: Original strand, 6640236 - 6640472
Alignment:
| Q |
12 |
atgaatattcaaacgaaggtatcacaaacctttagaaccaataaatttttatttaatacttcaatgctgtcatggttttatagatctatgatatttaatt |
111 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6640236 |
atgaatattcaaacgaaggaatcacaaacctttagaaccaataaatttttatttaatacttcaatgctgtcatggttttatagatctatgatatttaatt |
6640335 |
T |
 |
| Q |
112 |
tgtgatgttggtttcttgtttgtccttggttttccccaattattaactctacacttttaacttttgaatttattactcgatcaagttgaaagcttgcaga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6640336 |
tgtgatgttggtttcttgtttgtccttggttttccccaattattaactctacacttttaacttttgaatttattactcgatcaagttgaaagcttgcaga |
6640435 |
T |
 |
| Q |
212 |
tgtctgcgctctgcagaatgagaagatgggtacattg |
248 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6640436 |
tctctgcgctctgcagaatgagaagatgggtacattg |
6640472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 26 - 74
Target Start/End: Original strand, 15129701 - 15129749
Alignment:
| Q |
26 |
gaaggtatcacaaacctttagaaccaataaatttttatttaatacttca |
74 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
15129701 |
gaaggtatcacatacctttagaaccaataaatttttatttagtacttca |
15129749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University