View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4241_low_8 (Length: 229)
Name: NF4241_low_8
Description: NF4241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4241_low_8 |
 |  |
|
| [»] scaffold0187 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 13 - 215
Target Start/End: Original strand, 42185632 - 42185835
Alignment:
| Q |
13 |
gatatgaaacccttaacaatgtaagtcaaaactcaaaa-taannnnnnnaaagtttcctaccttgggattgatagcacaaactatagctaccgttgagta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42185632 |
gatatgaaacccttaacaatgtaagtcaaaactcaaaagtaatttttttaaagtttcctaccttgggattgatagcacaaactatagctaccgttgagta |
42185731 |
T |
 |
| Q |
112 |
cagcgcatagttactgattaagggtaacgttgtaatctgaaccgtagtatgtaaatacatgttggatgttgtaaatcctaaatttgaaataactgagagg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42185732 |
cagcgcatagttactgattaagggtaacgttgtaatctgaaccttagtatgtaaatacatattgtatgttgtaaatcctaaatttgaaataactgagagg |
42185831 |
T |
 |
| Q |
212 |
aact |
215 |
Q |
| |
|
|||| |
|
|
| T |
42185832 |
aact |
42185835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 129 - 170
Target Start/End: Complemental strand, 1849 - 1808
Alignment:
| Q |
129 |
ttaagggtaacgttgtaatctgaaccgtagtatgtaaataca |
170 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
1849 |
ttaagggtaattttgtaatctgaaccgtagtatttaaataca |
1808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University