View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4241_low_9 (Length: 210)
Name: NF4241_low_9
Description: NF4241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4241_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 12 - 195
Target Start/End: Original strand, 44817199 - 44817382
Alignment:
| Q |
12 |
acatcatccctgagattttttgttggtgattattttcattgctgtaaaataattgttcaacaagagtagatgttatatgcctttcatttattgtcatttt |
111 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44817199 |
acatcatacctgagattttttgttggtgattattttcattgctgtaaaataattgttcaacaagagtagatgttatatgcctttcatttattgtcatttt |
44817298 |
T |
 |
| Q |
112 |
ataggttaaggtgccattttcttcgtttgttttagtcctatactattaggttgaaagttttctcgttcatcaaaccttggtaat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44817299 |
ataggttaaggtgccattttcttcgtttgttttagtcctatactattaggttgaaagttttctcgttcatcaaaccttggtaat |
44817382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University