View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4243_high_5 (Length: 317)
Name: NF4243_high_5
Description: NF4243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4243_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 28960444 - 28960690
Alignment:
| Q |
1 |
atgatgttgaaaaaatgtcctatggttcttctcctgcaggttcaccacctcaccaaaattttcactactatctttcttctcctattcaccactcccgtga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
28960444 |
atgatgttgaaaaaatgtcctatggttcttctcctgcaggttcaccacctcaccaaaattttcactactatctttcttcccctattcaccactctcgtga |
28960543 |
T |
 |
| Q |
101 |
atcttctacttctcgttactctgcttccttgaaaaaccctaggatttcttcttcttggaagaagctgaataatagaaatggtggtgatgatcttgatgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28960544 |
atcttctacttctcgttactctgcttccttgaaaaaccctaggatttcttcttcttggaagaagctaaataatagaaatggtggtgatgatcttgatgaa |
28960643 |
T |
 |
| Q |
201 |
gaagatgaggatgatgaaggtgtttatgattctgggaggaatgttag |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28960644 |
gaagatgaggatgatgaaggtgtttatgattctgggaggaatgttag |
28960690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University