View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4243_low_9 (Length: 256)

Name: NF4243_low_9
Description: NF4243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4243_low_9
NF4243_low_9
[»] chr4 (1 HSPs)
chr4 (8-164)||(28961027-28961183)


Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 8 - 164
Target Start/End: Complemental strand, 28961183 - 28961027
Alignment:
8 gagaagaagagggcagttctgtcatttcacaatgcatacaccattgactctgaccagttgattgagttcaaacttgaaaaagttgagacttttgatactg 107  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28961183 gagaagaagagggcagttatgtcatttcacaatgcatacaccattgactctgaccagttgattgagttcaaacttgaaaaagttgagacttttgatactg 28961084  T
108 aaaagtttaaagaaagcatgaaagaatccaattgctttgatatgaggcatgcacgca 164  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28961083 aaaagtttaaagaaagcatgaaagaatccaattgctttgatatgaggcatgcacgca 28961027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University