View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4244_high_17 (Length: 236)
Name: NF4244_high_17
Description: NF4244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4244_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 43056400 - 43056607
Alignment:
| Q |
1 |
attacttgtggggtgtcttcagaaaaaagcaaacttcaaatgagacaaattatgttgtgactgcgtgttgattctaagtattttatttgagtagtgaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
43056400 |
attacttgtggggtgtcttcagaaaaaagcaaacttcaaatgagacaaattatgttgtgactcagtgttgattctaagtatttt----gagtagtgaata |
43056495 |
T |
 |
| Q |
101 |
gttttagttgtaatgcatagtacccctgtagtggttatatgtatgatgagaatatgagatgttgtaatgaattgtttgaattgttatttaccctttttat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43056496 |
gttttagttgtaatgcatagtacccctgtagtggttatatgtatgatgagaatatgagatgttgtaa---------tgaattgttatttaccctttttat |
43056586 |
T |
 |
| Q |
201 |
tacttatttgtgtattgttta |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
43056587 |
tacttatttgtgtattgttta |
43056607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 44806228 - 44806277
Alignment:
| Q |
1 |
attacttgtggggtgtcttcagaaaaaagcaaacttcaaatgagacaaat |
50 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| | ||||||||| |
|
|
| T |
44806228 |
attacttgtggggtgtcttcaaaaaaaagcaaacttcacacgagacaaat |
44806277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University