View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4244_low_18 (Length: 242)
Name: NF4244_low_18
Description: NF4244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4244_low_18 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 242
Target Start/End: Original strand, 31929092 - 31929316
Alignment:
| Q |
18 |
gaaacgtcgtcgcttgcgcctgcgtttgcaaacggtggagagatatcacacgtgaggtcgtagggtcaccttcgcttaacggcaaaattactttcccttc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
31929092 |
gaaacgtcgtcgcttgcgcctgcgtttgcaaacggtggagagatatcacacgtgaggtcgtagggtcaccttctcttaacggcaaaataactttcccttc |
31929191 |
T |
 |
| Q |
118 |
ttgtcttaaacaggtcctgcaacataatgaattcattttatttttatctcttgaataatttatggatcatgaaaaatatggatgtaataatacattattt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31929192 |
ttgtcttaaacaggtcctgcaacataatgaattcattttatttttctctcttgaataatttatggatcatgaaaaatttggatgtaataatacattattt |
31929291 |
T |
 |
| Q |
218 |
ttcttcataatgtagactaacattt |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
31929292 |
ttcttcataatgtagactaacattt |
31929316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 132
Target Start/End: Original strand, 31923086 - 31923199
Alignment:
| Q |
19 |
aaacgtcgtcgcttgcgcctgcgtttgcaaacggtggagagatatcacacgtgaggtcgtagggtcaccttcgcttaacggcaaaattactttcccttct |
118 |
Q |
| |
|
||||||||||||||| |||||||| || ||||||||||||||||| ||||||||| |||| ||||||| | |||||||| ||| || || |||||| |
|
|
| T |
31923086 |
aaacgtcgtcgcttgtgcctgcgtgtgtaaacggtggagagatattacacgtgagatcgttaagtcacctcaacgtaacggcacaatcacctttccttct |
31923185 |
T |
 |
| Q |
119 |
tgtcttaaacaggt |
132 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
31923186 |
tgtcttaaacaggt |
31923199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University