View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4246_high_14 (Length: 310)
Name: NF4246_high_14
Description: NF4246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4246_high_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 13 - 292
Target Start/End: Complemental strand, 37170380 - 37170101
Alignment:
| Q |
13 |
tgaagttgtttgtagtttctaaactatggcgnnnnnnngttttgagtgtttcaggtgggaattgcctgaagcaaaacatggggtttcagcttctactgct |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37170380 |
tgaacttgtttgtagtttctaaactatggcgtttttttgttttgagtgtttcaggtgggaattgcctgaagcaaaacatggggtttcagcttctactgcc |
37170281 |
T |
|
| Q |
113 |
aatgaattgcgtcaggatcggtatgatgtctatgttaacccggaaaagttgaaagcagcatctgaagggcttgcaaatcgtatgtatcattcttctcata |
212 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37170280 |
aatgaattgcgtcaggatcggtatgacgtcaatgttaacccggaaaagttgaaagcagcatctgaagggcttgcaaatcgtatgtatcattcttctcata |
37170181 |
T |
|
| Q |
213 |
ttaatttggttgcgatgaatgctctcattttctcattgtaggttaaggctgtaagcaattctcaataaaaacaaggtgta |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37170180 |
ttaatttggttgcgatgaatgctctcattttctcattgtaggttaaggctgtaagcaattctcaataaaaacaaggtgta |
37170101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University