View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4246_high_24 (Length: 227)
Name: NF4246_high_24
Description: NF4246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4246_high_24 |
 | |
|
| [»] scaffold0001 (1 HSPs) |
| | |
|
| [»] scaffold0247 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 212
Target Start/End: Complemental strand, 33904002 - 33903808
Alignment:
| Q |
18 |
gatgactccttttgggatttcaacctttgtgatttcgattctctttgagatctttatatattggttttggtgatatatttgccaataatatttcttagga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33904002 |
gatgactccttttgggatttcaacctttgtgatttcgattctctttgagatctttatatattggttttggtgatatatttgccaataatatttcttagga |
33903903 |
T |
|
| Q |
118 |
aaaatgtattttctatattatactatcaataatttatcagggtcttcttacaaggagagctatatggaataatttatctcatcaattcggttcat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33903902 |
aaaatgtattttctatattatactatcaataatttatcagggtcttcttacaaggagagctatatggaataatttatctcatcaattcggttcat |
33903808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 22 - 73
Target Start/End: Complemental strand, 33762335 - 33762284
Alignment:
| Q |
22 |
actccttttgggatttcaacctttgtgatttcgattctctttgagatcttta |
73 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
33762335 |
actccttttgggattccaacctttgtgatttcatttctctttgagatcttta |
33762284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 18 - 74
Target Start/End: Complemental strand, 33733784 - 33733728
Alignment:
| Q |
18 |
gatgactccttttgggatttcaacctttgtgatttcgattctctttgagatctttat |
74 |
Q |
| |
|
||||||||| ||||| ||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33733784 |
gatgactccctttggaattccaacctttgtgatttcgattctcttttggatctttat |
33733728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 18 - 131
Target Start/End: Complemental strand, 148399 - 148286
Alignment:
| Q |
18 |
gatgactccttttgggatttcaacctttgtgatttcgattctctttgagatctttatatattggttttggtgatatatttgccaataatatttcttagga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| ||||| ||| ||||||||||||||| ||||||||||||| ||||| |||||| |
|
|
| T |
148399 |
gatgactccttttgggatttcaacctttgtgattacgattctcttttagatcattagatattggttttggtgtaatatttgccaatactattttttagga |
148300 |
T |
|
| Q |
118 |
aaaatgtattttct |
131 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
148299 |
aaaatgtattttct |
148286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 21305520 - 21305468
Alignment:
| Q |
18 |
gatgactccttttgggatttcaacctttgtgatttcgattctctttgagatct |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
21305520 |
gatgactccttttgggatttcaacctttgtgatttgaattctctttgggatct |
21305468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0247 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0247
Description:
Target: scaffold0247; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 18 - 73
Target Start/End: Original strand, 22587 - 22642
Alignment:
| Q |
18 |
gatgactccttttgggatttcaacctttgtgatttcgattctctttgagatcttta |
73 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||| || | |||| |||||||||| |
|
|
| T |
22587 |
gatgactccttttgggatttcaacttttctgattttgaatttcttcgagatcttta |
22642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 26 - 73
Target Start/End: Original strand, 5471668 - 5471715
Alignment:
| Q |
26 |
cttttgggatttcaacctttgtgatttcgattctctttgagatcttta |
73 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||| |||||||| |
|
|
| T |
5471668 |
cttttgggatttcaacatttgtgattatgattctctttgggatcttta |
5471715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University