View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4246_low_16 (Length: 333)
Name: NF4246_low_16
Description: NF4246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4246_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 16 - 318
Target Start/End: Complemental strand, 38125346 - 38125043
Alignment:
| Q |
16 |
caccttccaaaagaggaactctgcagacagctgaatgcaaacactctttggtggcagtaattgttgatacatgttgcctttccatgcttccccaagcttc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38125346 |
caccttccaaaagaggaactctgcagacagctgaatgcaaacactctttggtggcagtaattgttgatacatgttgcctttccatgcttccccaagcttc |
38125247 |
T |
 |
| Q |
116 |
taataactttaactatcaaaaacaacaatacatcagtcaagaatattgaattaattac-nnnnnnnntttggtagatattaatcaaaattaggtttactt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38125246 |
taataactttaactatcaaaaacaacaatacatcagtcaagaatattgaattaattacaaaaaaaattttggtagatattaatcaaaattaggtttactt |
38125147 |
T |
 |
| Q |
215 |
cttacttggtaatataatataaaagcttttttcatttcaagcttttctcttgcaaactgtatcttctttttcataacagtatttctggacttggtgagac |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38125146 |
cttacttggtaatataatataaaagcttttttcatttcaagcttttctcttgcaaactgtatcttctttttcataacagtatttctggacttggtgagac |
38125047 |
T |
 |
| Q |
315 |
catc |
318 |
Q |
| |
|
|||| |
|
|
| T |
38125046 |
catc |
38125043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University