View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4247_low_15 (Length: 227)
Name: NF4247_low_15
Description: NF4247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4247_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 8 - 208
Target Start/End: Original strand, 45695427 - 45695620
Alignment:
| Q |
8 |
agcagcacagacaagaggtggtgccattcttccgtcttggatgattcgtcctataaatgaatagtagcagaaaaagataattacgtacatttgtagtatt |
107 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45695427 |
agcagcacaaacaagaggtggtgccattcttccgtcttggatgattcgtcctataaatgaatagtagcagaaaaagataattacgtacatttgtagtatt |
45695526 |
T |
|
| Q |
108 |
gtaccacttttctttattcaaaacacaaaaacagcttgtaggaagcctatagatatagtatatcatcgatatagcctataggcatatgatggttgatgac |
207 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45695527 |
gtaccacttttctttattcaaaacccaaaaacagcttgtaggaagcctatagatatagtatatcatcga-------tataggcatatgatggttgatgac |
45695619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University