View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4247_low_16 (Length: 224)
Name: NF4247_low_16
Description: NF4247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4247_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 20 - 221
Target Start/End: Original strand, 17223159 - 17223360
Alignment:
| Q |
20 |
agagggagactttttcttgctgtatgtgctaacttcggaaagagtaacttgagaacttgcttttcctcttttagccctgagccgtttctcatgttccaca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17223159 |
agagggagactttttcttgctgtatgtgctaacttcggaaagagtaacttgagaacttgcttttcctcttttagccctgagccgtttctcatgttccaca |
17223258 |
T |
|
| Q |
120 |
acttctgagccgatcattgagctggagtcactcttcgcacgtcgaagctctgacatggcttgatggcttagttgatcatgatgatcattttgatgatgtc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| || |
|
|
| T |
17223259 |
acttctgagccgatcattgagctggagtcactcttcgcacgtcgaagctctgacatggcttcatggcttagttgatcatgatgatcattttgatgatatc |
17223358 |
T |
|
| Q |
220 |
ca |
221 |
Q |
| |
|
|| |
|
|
| T |
17223359 |
ca |
17223360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University