View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4248_low_12 (Length: 266)
Name: NF4248_low_12
Description: NF4248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4248_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 6e-43; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 162 - 254
Target Start/End: Complemental strand, 33488795 - 33488703
Alignment:
| Q |
162 |
ttcttaacaaatattttatcaaaacaaacaaaatacttatataatattgacttaagcagtctcttgtatattttgattatttttcagttgatg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33488795 |
ttcttaacaaatattttatcaaaacaaacaaaatacttatataatattgacttaagcagtctcttgtatattttgattatttttcatttgatg |
33488703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 26 - 73
Target Start/End: Complemental strand, 33488868 - 33488821
Alignment:
| Q |
26 |
aacagctgaatttcttctatatgatggtgtaacaatctcatgtggcaa |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33488868 |
aacagctgaatttcttctatatgatggtgtaacaatctcatgtggcaa |
33488821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 26 - 74
Target Start/End: Original strand, 1611086 - 1611134
Alignment:
| Q |
26 |
aacagctgaatttcttctatatgatggtgtaacaatctcatgtggcaaa |
74 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||| ||| |||| |
|
|
| T |
1611086 |
aacagctgaatttcttctcaaggatggtgtaacaatctcaggtgtcaaa |
1611134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 73 - 101
Target Start/End: Original strand, 1611151 - 1611179
Alignment:
| Q |
73 |
aatcattcatcatctctcttctatgataa |
101 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1611151 |
aatcattcatcatctctcttctatgataa |
1611179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University