View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4249_high_3 (Length: 228)
Name: NF4249_high_3
Description: NF4249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4249_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 13 - 204
Target Start/End: Original strand, 44436887 - 44437080
Alignment:
| Q |
13 |
gagatgaagagattgtga--tgaccgagtttccacccttgttaaccttaacatgacaaggtaaaaaccttcaaagtcccataaatttagcccgccatgat |
110 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44436887 |
gagatgaagagattgtgacatgactgagtttccacccttgttaaccttaacatggcaaggtaaaaaccttcaaagtcccataaatttagcccgccatgat |
44436986 |
T |
 |
| Q |
111 |
atttgtttgtcgctctatcctaccttaacctcaaggttatgaccaccannnnnnnggttttccaacatagggaatttaacatgagctcaatttc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44436987 |
atttgtttgtcgctctatcctaccttaacctcaaggttatgaccaccatttttttggtattccaacatagggaatttaacatgagctcaatttc |
44437080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University