View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4249_low_2 (Length: 295)
Name: NF4249_low_2
Description: NF4249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4249_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 7 - 234
Target Start/End: Original strand, 45550536 - 45550763
Alignment:
| Q |
7 |
aaaccttcttctcaggaaggttgtccagtcccattagtttggctattacgtttggaatccttcccttgtcggccatctggtttgaaatgtcggcagctct |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45550536 |
aaaccttcttctcaggaaggttgtccagtcccattagtttggctattacgtttggaatccttcccttgtcggccatctggtttgaaatgtcggcagctct |
45550635 |
T |
|
| Q |
107 |
gccagtgttagttgatgttcgcttccgctgagaatcttttatctttctggtttccttagagttagtgattgtaattgctctctgcatcttgttgtcaacc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45550636 |
gccagtgttagttgatgttcgcttccgctgagaatcttttatctttttggtttccttagagttggtgattgtaattgctctctgcatcttgttgtcaacc |
45550735 |
T |
|
| Q |
207 |
gagaaagttggacgtgccagttgcattt |
234 |
Q |
| |
|
||||||||||||||||||||||| |||| |
|
|
| T |
45550736 |
gagaaagttggacgtgccagttgtattt |
45550763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University