View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4249_low_3 (Length: 243)
Name: NF4249_low_3
Description: NF4249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4249_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 54985619 - 54985440
Alignment:
| Q |
1 |
ctaaatcaatatttccgtatttcaaaagcaagaatcttacttgatgcaaaagtctcatattctagttttagtatagtctatgtttggctacaatttcgga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
54985619 |
ctaaatcaatatttccgtatttcaaaagcaagaatcttacttgatgcaaaagtctcatattctagctttaatatagtctatgtttggctacaatttcgga |
54985520 |
T |
 |
| Q |
101 |
gaggaaaaaattaattctagaactaacatagtgtggcacatttagaagataaatgtgtcccttaagcatgtggtcatggt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54985519 |
gaggaaaaaattaattctagaactaacatagtgtggcacatttagaagataaatgtgtcccttaagcatgtggtcatggt |
54985440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 227
Target Start/End: Complemental strand, 54985444 - 54985416
Alignment:
| Q |
199 |
atggtagagcactttttaaaagaggtaag |
227 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
54985444 |
atggtagagcactttttaaaagaggtaag |
54985416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University