View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4249_low_4 (Length: 241)
Name: NF4249_low_4
Description: NF4249
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4249_low_4 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 241
Target Start/End: Complemental strand, 24272287 - 24272058
Alignment:
| Q |
19 |
agaggatggtaattagggaaccttttttagtcttggtttaccataatgaatgacctataatcttgagttcaatacccgtgtgactaattagtggtatcaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24272287 |
agaggatggtaattagggaaccttttttagtcttggtttaccgtaatgaatgacctataatcttgagttcaatacccgtgtgactaattagtggtatcaa |
24272188 |
T |
|
| Q |
119 |
t---gtttctctttg----gtaccatgacaaatatgttgtggcatgatatgaactatcttgttttctcaatgacatgccttgatcatgagcattttttaa |
211 |
Q |
| |
|
| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24272187 |
tctactttctctttggtacgtaccatgacaaatatgttgtggcatgatatgaactatcttgttttctcaatgacatgccttgatcatgagcattttttaa |
24272088 |
T |
|
| Q |
212 |
gtaatcttttgaggtatttgcattcaattc |
241 |
Q |
| |
|
||||||||||||||||| |||||||||||| |
|
|
| T |
24272087 |
gtaatcttttgaggtatctgcattcaattc |
24272058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University