View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4250_high_2 (Length: 402)

Name: NF4250_high_2
Description: NF4250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4250_high_2
NF4250_high_2
[»] chr1 (1 HSPs)
chr1 (18-115)||(7874614-7874711)


Alignment Details
Target: chr1 (Bit Score: 86; Significance: 5e-41; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 18 - 115
Target Start/End: Original strand, 7874614 - 7874711
Alignment:
18 tgtgtaattaaacttcagccatattttaactattataataataatacccctgcatgtgaaattatgcttattcgggaaatcttgctttgaatttgaaa 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |||||    
7874614 tgtgtaattaaacttcagccatattttaactattataataataatacccctgcatgtgaaattatgcttattcgggaaatcttggttagaatatgaaa 7874711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University