View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4250_low_3 (Length: 402)
Name: NF4250_low_3
Description: NF4250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4250_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 86; Significance: 5e-41; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 18 - 115
Target Start/End: Original strand, 7874614 - 7874711
Alignment:
| Q |
18 |
tgtgtaattaaacttcagccatattttaactattataataataatacccctgcatgtgaaattatgcttattcgggaaatcttgctttgaatttgaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||| |
|
|
| T |
7874614 |
tgtgtaattaaacttcagccatattttaactattataataataatacccctgcatgtgaaattatgcttattcgggaaatcttggttagaatatgaaa |
7874711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University