View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4250_low_7 (Length: 375)
Name: NF4250_low_7
Description: NF4250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4250_low_7 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 9 - 375
Target Start/End: Complemental strand, 50655037 - 50654676
Alignment:
| Q |
9 |
atcatcaatcatatcccaatattcat--gactgagaaagatagaaatcaatatcttagnnnnnnnnnnnnnnnngttgagggaaaatcaatatcatagtg |
106 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
50655037 |
atcatcaatcatatcccaatattcatatgattgagaaagatagaaatcaatatcttagtttttttttt-------ttgagggaaaatcaatatcatagtg |
50654945 |
T |
|
| Q |
107 |
actgaatcattttgcaattcataagtaacattcattagtctttttagcatagtataagtttcctcacttgaactgattggtttgctctcaaatgatacaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
50654944 |
actgaatcattttgcaattcataagtaacattcattagtctttttagcatagtataattttcctcacttgaactaattggtttgctctcaaatgatacaa |
50654845 |
T |
|
| Q |
207 |
tcttcttaattacagattccaattttatgtggactaacagatccttagttcgggttaatggtttttgttgaactataggttttggattttatttggttgc |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50654844 |
tcttcttaattacagattccaattttatgtggactaacagatccttagttcgggttattggtttttgttgaactataggttttggattttatttggttgc |
50654745 |
T |
|
| Q |
307 |
atcaattgttgtcttgaattcatgtttacccattatttgttgttattgatgttattgttatccctggac |
375 |
Q |
| |
|
|| |||||||||| ||||||| |||| |||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
50654744 |
ataaattgttgtcgtgaattcctgttcacccattatttgttattactgatgttattgttatccctggac |
50654676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University