View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4252-Insertion-11 (Length: 54)
Name: NF4252-Insertion-11
Description: NF4252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4252-Insertion-11 |
 | |
|
| [»] chr6 (6 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 53; Significance: 3e-22; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 3e-22
Query Start/End: Original strand, 2 - 54
Target Start/End: Complemental strand, 3564316 - 3564264
Alignment:
| Q |
2 |
tagctaacctaccattttttagttctttcaccttcaactctgcaaaagcctcg |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3564316 |
tagctaacctaccattttttagttctttcaccttcaactctgcaaaagcctcg |
3564264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 3e-22
Query Start/End: Original strand, 2 - 54
Target Start/End: Complemental strand, 3569964 - 3569912
Alignment:
| Q |
2 |
tagctaacctaccattttttagttctttcaccttcaactctgcaaaagcctcg |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3569964 |
tagctaacctaccattttttagttctttcaccttcaactctgcaaaagcctcg |
3569912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.00000000000001
Query Start/End: Original strand, 2 - 53
Target Start/End: Complemental strand, 3573011 - 3572960
Alignment:
| Q |
2 |
tagctaacctaccattttttagttctttcaccttcaactctgcaaaagcctc |
53 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
3573011 |
tagctaaccttccatttttgagttctttcacctttaactctgcaaaagcctc |
3572960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 36; E-Value: 0.000000000004
Query Start/End: Original strand, 2 - 53
Target Start/End: Complemental strand, 3576295 - 3576244
Alignment:
| Q |
2 |
tagctaacctaccattttttagttctttcaccttcaactctgcaaaagcctc |
53 |
Q |
| |
|
|||||| ||||||||| || |||||||||||||| ||||||||||||||||| |
|
|
| T |
3576295 |
tagctagcctaccattcttaagttctttcacctttaactctgcaaaagcctc |
3576244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 35; E-Value: 0.00000000001
Query Start/End: Original strand, 4 - 54
Target Start/End: Original strand, 3584925 - 3584975
Alignment:
| Q |
4 |
gctaacctaccattttttagttctttcaccttcaactctgcaaaagcctcg |
54 |
Q |
| |
|
|||||||||||||| || |||||||| ||||| |||||||||||||||||| |
|
|
| T |
3584925 |
gctaacctaccattcttgagttctttaacctttaactctgcaaaagcctcg |
3584975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 32; E-Value: 0.0000000009
Query Start/End: Original strand, 2 - 53
Target Start/End: Complemental strand, 3578151 - 3578100
Alignment:
| Q |
2 |
tagctaacctaccattttttagttctttcaccttcaactctgcaaaagcctc |
53 |
Q |
| |
|
|||||||||| ||||| || |||||||| ||||| ||||||||||||||||| |
|
|
| T |
3578151 |
tagctaacctgccattcttgagttctttaacctttaactctgcaaaagcctc |
3578100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University