View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4252-Insertion-13 (Length: 219)
Name: NF4252-Insertion-13
Description: NF4252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4252-Insertion-13 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 6 - 219
Target Start/End: Complemental strand, 7835499 - 7835286
Alignment:
| Q |
6 |
ttataaagcgcaagtaagttgtttatccggaaaaacacatgcatctttatcgtgattatgcaaaggttaaaaaatatagcttttgaaaaattagaatgaa |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7835499 |
ttataaagcgcaagtaagttgtttatccggaaaaacacatgcatctttaccgtgattatgcaaaggttaaaaaatatagcttttgaaaaattagaatgaa |
7835400 |
T |
|
| Q |
106 |
taatctttaattatatcgaattcaccgtggtgccaaattgcaataactcaa-ccccactcaaatagcgataattcaactctactcaaatattacccttga |
204 |
Q |
| |
|
| ||| |||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7835399 |
tgatc-ttaattatgtcgaattcaccgtggtgccaaattgcaataactcaacccccactcaaatagcgataattcaactctactcaaatattacccttga |
7835301 |
T |
|
| Q |
205 |
ttgaatgtttgtcct |
219 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
7835300 |
ttgaatgtttgtcct |
7835286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University