View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4252-Insertion-15 (Length: 101)
Name: NF4252-Insertion-15
Description: NF4252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4252-Insertion-15 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 3e-48; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 3e-48
Query Start/End: Original strand, 5 - 101
Target Start/End: Complemental strand, 33014593 - 33014497
Alignment:
| Q |
5 |
cggtggttgtcgaggagagtaacgagagaggtggcggcgggccagagctggaaggagaggccttgagatgggagtgagcgaatggtgaccgttgatt |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33014593 |
cggtggttgtcgaggagagtaacgagagaggtggcggcgggccagagctggaaggagaggccttgagatgggagtgagcgaatggtgaccgttgatt |
33014497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University