View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4252-Insertion-9 (Length: 137)
Name: NF4252-Insertion-9
Description: NF4252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4252-Insertion-9 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 4e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 4e-67
Query Start/End: Original strand, 1 - 137
Target Start/End: Original strand, 31351591 - 31351727
Alignment:
| Q |
1 |
ctaatggctcaacatctacaagcattacaaaatgtattaactcaccaaaattgtctacttgataatcatgaactagttcgaaatttgctggtctcttagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
31351591 |
ctaatggctcaacatctacaagcattacaaaatgtattaactcaccaaaattgtctacttgataatcatgaactagttcaaaatttgctggtctctcagg |
31351690 |
T |
 |
| Q |
101 |
aagttgtttgtttctatgtagtctaacattcacatcg |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31351691 |
aagttgtttgtttctatgtagtctaacattcacatcg |
31351727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University