View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4252_low_9 (Length: 234)
Name: NF4252_low_9
Description: NF4252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4252_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 18 - 216
Target Start/End: Original strand, 38386645 - 38386845
Alignment:
| Q |
18 |
gacggcacatgggaatgagaaacaagaacaactctaattgaaagagaattgaggagctacacgggcaacacatcataactctatcggtttaatttctcta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |||||||||| |||| |
|
|
| T |
38386645 |
gacggcacatgggaatgagaaacaagaacaactctaattgaaagagaattgaggagctacacaggcaacacatcagaactctattggtttaatttttcta |
38386744 |
T |
|
| Q |
118 |
ctatgtttcttatttctaa--ctcatagagattaggtctaaaatgaatctaatgtactctgttttgaaccaaccatgttgttgtgaaactctatttcata |
215 |
Q |
| |
|
|||| |||||||||||||| ||| |||||||||||||| | |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38386745 |
ctatctttcttatttctaaatctcttagagattaggtctgagatgaatctaatgtattctgttttgaaccaaccatgttgttgtgaaactctatttcata |
38386844 |
T |
|
| Q |
216 |
t |
216 |
Q |
| |
|
| |
|
|
| T |
38386845 |
t |
38386845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 214
Target Start/End: Original strand, 31575162 - 31575190
Alignment:
| Q |
186 |
aaccatgttgttgtgaaactctatttcat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31575162 |
aaccatgttgttgtgaaactctatttcat |
31575190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 214
Target Start/End: Complemental strand, 35521743 - 35521715
Alignment:
| Q |
186 |
aaccatgttgttgtgaaactctatttcat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35521743 |
aaccatgttgttgtgaaactctatttcat |
35521715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University