View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4253-Insertion-1 (Length: 112)
Name: NF4253-Insertion-1
Description: NF4253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4253-Insertion-1 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 1e-50; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 1e-50
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 32752787 - 32752677
Alignment:
| Q |
1 |
tcttctaaattcaccaatattcatttcagttcacacactttccacgtagtactcttatngtgtgtatacaaccatttcttttttcctacgctttctatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32752787 |
tcttctaaattcaccaatattcatttcagttcacacactttccacgtagtactcttattgtgtgtatacaaccatttcttttttcc-acgctttctatct |
32752689 |
T |
|
| Q |
101 |
acaaataacact |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
32752688 |
acaaataacact |
32752677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University