View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4253-Insertion-3 (Length: 131)
Name: NF4253-Insertion-3
Description: NF4253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4253-Insertion-3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 130; Significance: 9e-68; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 130; E-Value: 9e-68
Query Start/End: Original strand, 1 - 130
Target Start/End: Complemental strand, 24581666 - 24581537
Alignment:
| Q |
1 |
ttgatttacatttttaattcacaattttcttttagaacttctcaaacgatatctttagaatttttcgtctgtatatggattgaaatggcttattttctag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24581666 |
ttgatttacatttttaattcacaattttcttttagaacttctcaaacgatatctttagaatttttcgtctgtatatggattgaaatggcttattttctag |
24581567 |
T |
 |
| Q |
101 |
acaaaactcttgaggaaattcttgacccat |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
24581566 |
acaaaactcttgaggaaattcttgacccat |
24581537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University