View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4253-Insertion-5 (Length: 124)
Name: NF4253-Insertion-5
Description: NF4253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4253-Insertion-5 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 5e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 5e-57
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 52479427 - 52479304
Alignment:
| Q |
1 |
aatacctagagcttaaatagaatcttcgaagcagtaattaggtgcattaattgtgataatgtgatggaatatggttaacaaattcttctcaaatgttatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52479427 |
aatacctagagcttaaatagaatcttcgaagcagtaattaagtgcattaattgtgataatgtgatggaatatggttcacaaattcttctcaaatgttatc |
52479328 |
T |
|
| Q |
101 |
gttccaattttttggtatgttcct |
124 |
Q |
| |
|
||| |||||||||||||||||||| |
|
|
| T |
52479327 |
gtttcaattttttggtatgttcct |
52479304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University