View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4253-Insertion-6 (Length: 116)
Name: NF4253-Insertion-6
Description: NF4253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4253-Insertion-6 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 2e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 2 - 116
Target Start/End: Complemental strand, 14271961 - 14271847
Alignment:
| Q |
2 |
cttcaccttccttgatttgattttcaaacagcttgggatgggaagcgcgctcgaaacactatgtggacaagcagtaggagctggaaaactcgacatgtta |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14271961 |
cttcaccttccttgatttgattttcaaacagcttgggatgggaagcgcgctcgaaacactatgtggacaagcagtaggagcaggaaaactcgacatgtta |
14271862 |
T |
|
| Q |
102 |
ggaatatacatgcaa |
116 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
14271861 |
ggaatatacatgcaa |
14271847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 36 - 116
Target Start/End: Complemental strand, 29112249 - 29112169
Alignment:
| Q |
36 |
gggatgggaagcgcgctcgaaacactatgtggacaagcagtaggagctggaaaactcgacatgttaggaatatacatgcaa |
116 |
Q |
| |
|
|||||||||||||| | || ||||||||||||||||| | ||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
29112249 |
gggatgggaagcgcattggagacactatgtggacaagctttcggagcagggaaactagacatgttaggaatatacatgcaa |
29112169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University