View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4253_low_6 (Length: 249)

Name: NF4253_low_6
Description: NF4253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4253_low_6
NF4253_low_6
[»] chr6 (1 HSPs)
chr6 (132-239)||(27792321-27792428)


Alignment Details
Target: chr6 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 132 - 239
Target Start/End: Complemental strand, 27792428 - 27792321
Alignment:
132 ctattaatgaactgtgaccatgtcgaatcaaagtactaattagttccaactcataactactaacttagtatatatacctattttgtaatggtcattgata 231  Q
    ||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
27792428 ctattaatgaactgtgaccatttcgaatcaaaatactaattagttccaactcataactactaacttagtatatgtacctattttgtaatggtcattgata 27792329  T
232 atgatatt 239  Q
     |||||||    
27792328 ctgatatt 27792321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University